• Users Online: 255
  • Home
  • Print this page
  • Email this page
Home About us Editorial board Ahead of print Current issue Search Archives Submit article Instructions Subscribe Contacts Login 


 
 Table of Contents  
ORIGINAL ARTICLE
Year : 2017  |  Volume : 12  |  Issue : 1  |  Page : 23-30

Prognostic importance of human leukocyte antigen DRβ1 gene and protein tyrosine phosphatase nonreceptor Type 22 gene polymorphism in rheumatoid arthritis


1 Department of Pathology, IMS, BHU, Varanasi, Uttar Pradesh, India
2 UGC Advance Immunodiagnostic Training and Research Centre, IMS, BHU, Varanasi, Uttar Pradesh, India
3 Department of Orthopedics, Sir Sunderlal Hospital, Banaras Hindu University, Varanasi, Uttar Pradesh, India
4 Department of Medicine, Sir Sunderlal Hospital, Banaras Hindu University, Varanasi, Uttar Pradesh, India

Date of Web Publication23-Feb-2017

Correspondence Address:
Pramod Kumar Verma
Room No. 417, 4th Floor, Laboratory Oncology, Dr. BRA Institute Rotary Cancer Hospital, All India Institute of Medical Sciences, New Delhi - 110 029
India
Login to access the Email id

Source of Support: None, Conflict of Interest: None


DOI: 10.4103/0973-3698.199122

Rights and Permissions
  Abstract 

Background: Major histocompatibility complex (MHC) or human leukocyte antigen (HLA) gene and some of the non-MHC genes are associated with genetic predisposition in rheumatoid arthritis (RA). The aim of the present study was to find the prevalence of HLA DRβ1 alleles and protein tyrosine phosphatase nonreceptor type 22 (PTPN22) gene single-nucleotide polymorphism (SNP) in RA patients and also assessed their correlation with laboratory and clinical parameters.
Materials and Methods: One hundred and fifty cases of RA and 100 healthy controls were studied. relation to RA patients. HLA DRβ1 typing was done by low-resolution sequence-specific primer polymerase chain reaction and auto-antibodies (Abs) (rheumatoid factor [RF], anti-cyclic citrullinated peptide 2 (CCP2) Ab, anti-nuclear Ab, double-stranded deoxyribose nucleic acid, anticardiolipin Ab) were done by enzyme-linked immunosorbent assay.
Results: In patients with RA, the most common HLA DRβ1 allele was DRβ1*04 (23.3%), followed by DRβ1*10 (20.7%), DRβ1*03 (9.3%), and DRβ1*01 (8.7%). Contrary to this, some alleles of DRβ1 were significantly less expressed in RA such as DRβ1*07 (P = 0.000) and DRβ1*14 (P = 0.010). DRβ1*04 positive patients had significantly more RF positivity while DRβ1*10 positive patients had increased RF and anti-CCP2 Ab. DRβ1*04 positive cases had positive correlation with disease activity score. DRβ1*10 positive patients had negative correlation with the age of the RA patients. These patients have shown early onset of disease. PTPN22 C1858T SNP was found in only 4% cases of RA. No correlation was established with PTPN22 SNP positivity and clinical parameters.
Conclusion: In our study, RA patients have less DRβ1*04 positivity as compared to the Western literature. In our area, DRβ1*10 is more common than DRβ1*01. HLA DRβ1*07 and *14 are found to be protective for RA. PTPN22 SNP has not shown any diagnostic or prognostic significance while a follow-up study may be useful for prognostic importance of HLA DRβ1 typing in RA.

Keywords: DRβ typing, rheumatoid factor, anti-cyclic citrullinated peptide


How to cite this article:
Verma PK, Singh U, Saraf SK, Singh NK. Prognostic importance of human leukocyte antigen DRβ1 gene and protein tyrosine phosphatase nonreceptor Type 22 gene polymorphism in rheumatoid arthritis. Indian J Rheumatol 2017;12:23-30

How to cite this URL:
Verma PK, Singh U, Saraf SK, Singh NK. Prognostic importance of human leukocyte antigen DRβ1 gene and protein tyrosine phosphatase nonreceptor Type 22 gene polymorphism in rheumatoid arthritis. Indian J Rheumatol [serial online] 2017 [cited 2017 May 29];12:23-30. Available from: http://www.indianjrheumatol.com/text.asp?2017/12/1/23/199122


  Introduction Top


Genetic association of rheumatoid arthritis (RA) is well recognized as the first-degree relatives of patients show likelihood of 2%–3% of disease prevalence. In monozygotic twins, the concordance of disease is approximately 15%–20%.[1],[2] The interplay of environmental and genetic factors possibly triggers the autoimmune activity of the RA. The risk alleles of RA are mostly located in the major histocompatibility complex (MHC) region of the short arm of chromosome 6. MHC contains human leukocyte antigen (HLA) gene and the HLA DRβ1 is the most important gene for the susceptibility of RA. It encodes MHC class II antigen which participates in CD4 T-cell immune response through antigen presentation.[3],[4],[5] The disease-associated HLA DRβ1 alleles share amino acid sequences (QKRAA) at position 70–74 in the third hypervariable region of HLA DRβ1 chain which is called as shared epitope. Some of these alleles were reported to be associated with anti-citrullinated peptide auto-antibody (Ab) production in RA patients.

Some of the DRβ1 alleles such as DRβ1*0401 are associated with high risk while others such as DRβ1 alleles (*0101, *0404, *1001, *0901) are associated with moderate risk.[5] The strong association of DR4 with RA in many ethnic groups is well established such as in American Blacks, Venezuelans, Mexicans, Chippewa Indians,[6],[7] Europeans,[3],[6],[8] Japanese,[9],[10] and Saudi Arabian population.[11] Genome-wide association studies involve the examination of genetic architecture of complex disease such as RA. Genotyping analysis of large control studies made the possibility to find out single-nucleotide polymorphisms (SNPs) that can contribute to RA susceptibility.[12] The role of genes of locus other than MHC region has also been studied, but they are mostly the genetic variations which take part in the susceptibility of autoimmune diseases including RA. In 2004, a variant within the gene protein tyrosine phosphatase nonreceptor type 22 (PTPN22) was identified which contributes to the risk for RA.[13] Gene of PTPN22 is situated on chromosome 1. It encodes protein tyrosine phosphatase which is involved in T-cell activation. Mutation can increase or decrease the T-cell function.[14]

India has a heterogeneous population of various races; hence, genetic makeup varies. DRβ1 typing has also shown to have variable results in North and South India.[7],[15],[16],[17],[18] The aim of the present study was to assess prevalence of susceptible and protective DRβ1 alleles and PTPN22 polymorphism in RA patients and controls and also to ascertain correlations with clinical and laboratory findings in RA patients.


  Methods Top


A total of 150 cases of RA and 100 healthy controls were studied within a period of 2 years (2011–2013). These cases were taken from outdoor and indoor of the Rheumatology Division of Department of Medicine of Sir Sunderlal Hospital, Banaras Hindu University, Varanasi, Uttar Pradesh, from 2010 to 2013. Healthy controls were the voluntary blood donors and not related to the patients. Patients were classified as RA the 1987 revised criteria of American College of Rheumatology (ACR)[19] and ACR and European League Against Rheumatism (EULAR) in 2010.[20] All our patients fulfilled both the criteria. Arthritis with radiological evidence of osteoarthritis or any evidence of known infection such as tuberculosis and osteomyelitis were excluded from the study. Patients with onset of disease after the age of 16 years were included in the study.

DRβ1 typing was done by low-resolution HLA sequence-specific primer DRβ1 typing kit of Morgan of Texas Biogene Inc., Taipei, Taiwan.

SNP genotyping rs_2476601, PTPN22 (lymphoid) was done by TaqMan (R) SNP genotyping assays, synthesized by Applied Biosystem/Invitrogen, Life Technology, USA.

Following target sequence was used;

ACCACAATAAATGATTCAGGTGTCC(A/G)TACAGGAAGTGAGGGGGGATTTCA, C-16021387 20 F, C-16021387 20 R, C-16021387-20-VVIC-NFQ-MGB, and C-16021387-20-MFAM-NFQ-MGB.

Data was analyzed using Statistical Package for Social Sciences (SPSS, Chicago, IL, USA), version 16. Chi-square or Fishers' exact test was used in correlations of different markers with case and controls. Spearman's rho correlation was used correlate presence of different DRβ1 alleles with age, duration, number of joints involved, and disease activity scores.

Ethical approval

Necessary approvals were obtained from the ethics committee of our institution. Informed written consent was obtained from all patients prior to their enrollment in this study.


  Results Top


In the present study the most common allele detected in RA patient was DRβ1*04 (23.3%), followed by DRβ1*10 (20.7%), DRβ*03 (9.3%), and DRβ1*01 (8.7%). All these alleles were significantly elevated in RA as compared to healthy controls. Relative risk was highest in DRβ1*01 (18.06%), followed by DRβ1*04 (5.83%), DRβ*03 (4.47), and DRβ1*10 (2.58). In total, 62.7% of patients had either DRβ1*01 or *04 or *03 or DRβ1*10. Contrary to this DRβ*07, DRβ1*14 was significantly less common in RA and acts as protective alleles for RA [Table 1].
Table 1: DRβ1 typing in rheumatoid arthritis and healthy controls

Click here to view


Correlation of DRβ1 alleles positivity with laboratory finding revealed that in DRβ1*01 positive patients, anti-CCP 2 Ab (100% vs. 88.3%), RF-IgM (84.6% vs. 72.3%), and C-reactive protein (CRP) (46.2% vs. 37.2%) positivity were more frequent as compared to healthy control, but statistically, this increase was not significant. ANA, dsDNA Ab, and ACLA positivity were more in DRβ*01 negative patient, but again it was statistically nonsignificant. DRβ1*04 positive cases showed significant high positivity of RF (91.4% vs. 67.8%). In DRβ1*10 positive patients, both RF (100% vs. 86.6%) and anti-CCP2 (93.5% vs. 68.1%) positivity were significantly high while *03 showed no correlation with auto-Abs [Table 2].
Table 2: Correlation of rheumatoid arthritis susceptible HLA DRβ1*01, *04, *10, *03 and protective alleles *07, *14 with various autoantibodies

Click here to view


Correlation of DRβ1 typing with clinical features did not reveal any significant association of DRβ1*01, DRβ1*10, DRβ1*03 with morning stiffness, swelling of joints, deformity, or subcutaneous nodule formation. Only DRβ1*04 positive cases showed significant negative correlation with morning stiffness. Subcutaneous nodule formation and deformity of joints were more in DRβ1*04 positive cases. Although it was not statistically significant, DRβ1*03 positive patients had no deformity or subcutaneous nodule formation [Table 3].
Table 3: Correlation of susceptible DRβ1 alleles *01, *04, *10, *03 and protective alleles *07, *14 with clinical feature of rheumatoid arthritis

Click here to view


HLA DRβ1*04 was found to be significantly associated with duration of disease (P = 0.032) and ACR/EULAR score (P = 0.001). The presence of DRβ1 *01, *10, or *03 has shown no significant association with age, duration of disease, joint involvement, or ACR/EULAR criteria score [Table 4].
Table 4: Correlation of susceptible HLA DRβ1 alleles *01, *04, *10, *03 and protective alleles *07, *14 with age, duration, number of joints involved, and American College of Rheumatology/European League Against Rheumatism criteria

Click here to view


Correlation of protective HLA DRβ1 alleles *07 and *14 with various auto-Abs and CRP in RA patients has shown significantly negative association of DRβ1 *07 allele with RF only (P = 0.001) [Table 2]. DRβ1 *07 allele was also found to be negatively associated with swelling of joints (P = 0.005) [Table 3]. None of protective DRβ1 alleles *07 or *14 have shown any association with age, duration, number of joints involved, and ACR/EULAR criteria score [Table 4].

SNP of PTPN22 was found in six patients of RA while no healthy control showed this SNP. Only heterozygous mutation was found and this was statistically significant. No homozygous mutant allele was found. All healthy controls were homozygous wild type of CC and this is significantly higher than RA (P = 0.000) [Table 5].
Table 5: Correlation of protein tyrosine phosphatase nonreceptor type 22 C1858T single-nucleotide polymorphism with rheumatoid arthritis and healthy controls

Click here to view


No significant correlation of PTPN22 mutation was found with anti-CCP2 Ab, RF-IgM positivity, CRP positivity, ANA, anti-dsDNA Ab, and ACLA positivity [Table 6].
Table 6: Correlation of autoantibodies with protein tyrosine phosphatase nonreceptor type 22 single-nucleotide polymorphism positivity

Click here to view


Similarly, no correlation was found between PTPN22 polymorphism with clinical features such as swelling and deformity of joints, subcutaneous nodule formation [Table 6], age, duration of disease and number of joints involved, and ACR/EULAR criteria score [Table 7], but morning stiffness was significantly less (P = 0.000) in a patient who had PTPN22 mutation [Table 6].
Table 7: Showing correlation of PTPN 22 C1858T SNP positivity with clinical parameter

Click here to view



  Discussion Top


In the present study, we found that the most significant HLA DRβ1 allele in RA was DRβ1*04 (23.3%), followed by DRβ1*10 (20.7%), DRβ1*03 (9.3%), and DRβ1*01 (8.7%). Like ours, Plenge et al., 2009[5] also reported increased prevalence of DRβ1*04, β1*01, and β1*10 in RA patients, but in comparison to our study, western literature reported higher positivity of DRβ1*04.

In European studies, more than 60% of patients of RA were DRβ1*04 positive.[3],[6],[8] In Japanese population also, DRβ*04 is seen in high frequency where 60%–70% patients are DRβ1*04 positive.[9],[10] In earlier study of Saudi population,[21] they reported that DRβ1*10 was the most common allele seen in RA patient; however, in 2006, another study [11] contradicted it and reported that DRβ1*04 was the most common allele in RA, followed by DRβ1*08 and DRβ1*10. Several workers from Northern India have also reported increased frequency of HLA DRβ*04 similar to us.[7],[15],[16],[17] A study conducted in South India has also found that DRβ1*04 and *10 is more common in RA patients.[18] We also found increased frequency of DRβ1*03 in RA. Similar findings were reported from Kuwait [22] and China [23],[24] where it was also found that DRβ1*03 as susceptible gene for RA.

Contrary to this, some workers [25],[26],[27] have found that DRβ1*03 is protective allele in RA. In our study we found DRβ1*07 and DRβ1*14 as protective allele in RA. A study from western India [28] found DRβ1*14 as protective allele for RA; however, in contrast to ours they found DRβ1*03 as a protective allele for RA.

A previous study from [29] India did not find any significant association of any HLA type with RA. This might have been due to small sample size moreover since. DRβ1 alleles are very polymorphic; hence, they could not find any susceptible or protective DRβ1 allele in RA. DRβ1 alleles 0101, 0102, 0104, 0401, 0405, 0408, 0413, 0416, and 1001 are shared epitope allele (SE allele).[30]

Several studies [31],[32],[33] found that SE alleles, specially DRβ1*04, are important for susceptibility as well as severity of disease. Van Gaalen et al., 2004[34] found the most severe progression was seen in RA patients who were positive for anti-CCP2 Ab, RF, and SE allele. Another study [35] also found that SE appears to confer susceptibility to RA which is also associated with anti-CCP2 Ab positivity.

Similar to these findings, in the present study, we also found that DRβ1*04 is associated with more RF IgM positivity while DRβ1*10 was associated with both IgM RF and anti-CCP 2 positivity. In our study, although DRβ1*04 positive patients had more subcutaneous nodule formation, deformity of joints, and chronicity of disease, it was not statistically significant.

PTPN22 C1858T SNP genotyping assay has revealed little role of this variation in RA pathogenesis. Most of the studies have shown positive association of PTPN22 polymorphism in RA in Caucasian population.[13],[36] Hinks et al.,[36] found PTPN22 polymorphism in both normal control (3%) and RA patients (17.8%) which were significantly higher. Burkhardt et al.,[37] from Germany also found high frequency of this variant in RA (21.3%) as compared to controls (10%).

We found six cases of RA (4%) having PTPN22 C1858T heterozygous mutation while none of the controls showed this variation. Another report from Western India showed no direct association between PTPN22 C1858T polymorphism and RA patients as only 9.4% of RF positive and 10.9% of anti-CCP2 Ab positive had shown C/T heterozygous mutation while none were T/T homozygous mutant.[38] More or less similar to our findings, Totaro et al.,[39] from Italy also noted low frequency (5.7%) of polymorphism in RA. In contrast to our study, some workers [40],[41] did not find significant association of PTPN22 variation with RA. Similarly, some of the earlier studies from India [42],[43] also did not find any association of PTPN22 mutation with RA.

One study from the Germany [37] found higher incidence of PTPN22 mutation in RA patients, but they did not find any association of this with anti-CCP2 Ab and RF titer.

Their results were similar to ours as we also did not find any association of PTPN22 with anti-CCP2 or RF positivity. Some studies from the West [43],[44] show that patient with PTPN22 mutation develops RA at early stage, but we did not find any association with age of patient, duration of disease, number of joints involved, or ACR/EULAR criteria score.

Positivity for DRβ1 *04, DRβ1*01 and more DRβ1*10 was seen in about 20% of our patients with RA, which is significantly less compared to data from the west and the most frequent DRβ1 allele detected was DRβ1*04. Susceptible gene HLA DRβ1*04 positivity was related to higher disease activity while DRβ1*07 and *14 positivity have shown a protective role.

Secondly we found low prevalence of PTPN22 mutation in both RA patients and nil among healthy controls. This might be the probable reason for mild extra-articular and articular manifestation and less deformity of joints in our RA patients.

In conclusion, HLA DRβ1 typing may help predict disease development in RA. Follow-up studies may reveal genetic predisposition and prognostic importance of HLA DRβ1 alleles.

Acknowledgment

We are thankful to Mr Ranjan, Miss Shailja and laboratory staff Mr. R U Singh, Mr. N Ram and Mr. S Mukharji for their support.

Financial support and sponsorship

We are thankful to the Indian Council of Medical Research, New Delhi, for financial support.

Conflicts of interest

There are no conflicts of interest.

 
  References Top

1.
Silman AJ, Ollier W, Holligan S, Birrell F, Adebajo A, Asuzu MC, et al. Absence of rheumatoid arthritis in a rural Nigerian population. J Rheumatol 1993;20:618-22.  Back to cited text no. 1
    
2.
Bellamy N, Duffy D, Martin N, Mathews J. Rheumatoid arthritis in twins: A study of aetiopathogenesis based on the Australian twin registry. Ann Rheum Dis 1992;51:588-93.  Back to cited text no. 2
    
3.
Stastny P. Association of the B-cell alloantigen DRw4 with rheumatoid arthritis. N Engl J Med 1978;298:869-71.  Back to cited text no. 3
    
4.
Gregersen PK, Silver J, Winchester RJ. The shared epitope hypothesis. An approach to understanding the molecular genetics of susceptibility to rheumatoid arthritis. Arthritis Rheum 1987;30:1205-13.  Back to cited text no. 4
    
5.
Plenge RM. Rheumatoid arthritis genetics: 2009 update. Curr Rheumatol Rep 2009;11:351-6.  Back to cited text no. 5
    
6.
Stastny P. Rheumatoid arthritis. In: Terasaki PJ, editor. Histocompatibility Testing. Los Angeles: UCLA, Tissue Typing Laboratory; 1980. p. 681-6.  Back to cited text no. 6
    
7.
Mehra NK, Vaidya MC, Taneja V, Agarwal A, Malaviya AN. HLA-DR antigens in rheumatoid arthritis in North India. Tissue Antigens 1982;20:300-2.  Back to cited text no. 7
    
8.
Gibofsky A, Winchester RJ, Patarroyo M, Fotino M, Kunkel HG. Disease associations of the Ia-like human alloantigens. Contrasting patterns in rheumatoid arthritis and systemic lupus erythematosus. J Exp Med 1978;148:1728-32.  Back to cited text no. 8
    
9.
Maeda H, Juji T, Mitsui H, Sonozaki H, Okitsu K. HLA DR4 and rheumatoid arthritis in Japanese people. Ann Rheum Dis 1981;40:299-302.  Back to cited text no. 9
    
10.
Sasazuki T, Kaneoka H, Ohta N, Hayase R, Iwamoto I. Four common HLA haplotypes and their association with diseases in the Japanese population. Transplant Proc 1979;11:1871-3.  Back to cited text no. 10
    
11.
Al-Swailem R, Al-Rayes H, Sobki S, Arfin M, Tariq M. HLA-DRB1 association in Saudi rheumatoid arthritis patients. Rheumatol Int 2006;26:1019-24.  Back to cited text no. 11
    
12.
Longo DL, Fauci AS, Kasper DL, Hauser SL, Jameson JL, Loscalzo J, editors. Rheumatoid arthritis, immune mediated injury, disorder of joint and adjacent tissue. In: Harrison's Basis of Principle of Internal Medicine. 18th ed. United States of America: McGraw-Hill Companies; 2012. p. 321.  Back to cited text no. 12
    
13.
Begovich AB, Carlton VE, Honigberg LA, Schrodi SJ, Chokkalingam AP, Alexander HC, et al. A missense single-nucleotide polymorphism in a gene encoding a protein tyrosine phosphatase (PTPN22) is associated with rheumatoid arthritis. Am J Hum Genet 2004;75:330-7.  Back to cited text no. 13
    
14.
Lee AT, Li W, Liew A, Bombardier C, Weisman M, Massarotti EM, et al. The PTPN22 R620W polymorphism associates with RF positive rheumatoid arthritis in a dose-dependent manner but not with HLA-SE status. Genes Immun 2005;6:129-33.  Back to cited text no. 14
    
15.
Taneja V, Mehra NK, Chandershekaran AN, Ahuja RK, Singh YN, Malaviya AN. HLA-DR4-DQw8, but not DR4-DQw7 haplotypes occur in Indian patients with rheumatoid arthritis. Rheumatol Int 1992;11:251-5.  Back to cited text no. 15
    
16.
Taneja V, Giphart MJ, Verduijn W, Naipal A, Malaviya AN, Mehra NK. Polymorphism of HLA-DRB, -DQA1, and -DQB1 in rheumatoid arthritis in Asian Indians: Association with DRB1*0405 and DRB1*1001. Hum Immunol 1996;46:35-41.  Back to cited text no. 16
    
17.
Agrawal S, Aggarwal A, Dabadghao S, Naik S, Misra R. Compound heterozygosity of HLA-DR4 and DR1 antigens in Asian Indians increases the risk of extra-articular features in rheumatoid arthritis. Br J Rheumatol 1995;34:41-4.  Back to cited text no. 17
    
18.
Mody GM, Hammond MG. Differences in HLA-DR association with rheumatoid arthritis among migrant Indian communities in South Africa. Br J Rheumatol 1994;33:425-7.  Back to cited text no. 18
    
19.
Arnett FC, Edworthy SM, Bloch DA, McShane DJ, Fries JF, Cooper NS, et al. The American Rheumatism Association 1987 revised criteria for the classification of rheumatoid arthritis. Arthritis Rheum 1988;31:315-24.  Back to cited text no. 19
    
20.
van der Linden MP, Knevel R, Huizinga TW, van der Helm-van Mil AH. Classification of rheumatoid arthritis: Comparison of the 1987 American College of Rheumatology criteria and the 2010 American College of Rheumatology/European League Against Rheumatism criteria. Arthritis Rheum 2011;63:37-42.  Back to cited text no. 20
    
21.
Al-Arfaj AS. Characteristics of rheumatoid arthritis relative to HLA-DR in Saudi Arabia. Saudi Med J 2001;22:595-8.  Back to cited text no. 21
    
22.
Sattar MA, Al-Saffar M, Guindi RT, Sugathan TN, Behbehani K. Association between HLA-DR antigens and rheumatoid arthritis in Arabs. Ann Rheum Dis 1990;49:147-9.  Back to cited text no. 22
    
23.
Alsaeid K, Haider MZ, Kamal H, Srivastva BS, Ayoub EM. Prevalence of human leukocyte antigen (HLA) DRB1 alleles in Kuwaiti children with juvenile rheumatoid arthritis. Eur J Immunogenet 2002;29:1-5.  Back to cited text no. 23
    
24.
Lin L, Chen Y, Xiao Z, Huang S, Yang Z. The association of HLA-DRB1 alleles with rheumatoid arthritis in the Chinese Shantou population: A follow-up study. Biochem Cell Biol 2007;85:227-38.  Back to cited text no. 24
    
25.
Jawaheer D, Li W, Graham RR, Chen W, Damle A, Xiao X, et al. Dissecting the genetic complexity of the association between human leukocyte antigens and rheumatoid arthritis. Am J Hum Genet 2002;71:585-94.  Back to cited text no. 25
    
26.
du Montcel ST, Michou L, Petit-Teixeira E, Osorio J, Lemaire I, Lasbleiz S, et al. New classification of HLA-DRB1 alleles supports the shared epitope hypothesis of rheumatoid arthritis susceptibility. Arthritis Rheum 2005;52:1063-8.  Back to cited text no. 26
    
27.
Bridges SL Jr., Kelley JM, Hughes LB. The HLA-DRB1 shared epitope in Caucasians with rheumatoid arthritis: A lesson learned from tic-tac-toe. Arthritis Rheum 2008;58:1211-5.  Back to cited text no. 27
    
28.
Prasannavar DJ, Yeola A, Pradhan V, Patwardhan M, Rajadhyaksha A, Ghosh K. Distribution of HLA-DRB1 alleles among well-characterized rheumatoid arthritis patients from Western India. Rheumatol Int 2014;34:705-8.  Back to cited text no. 28
    
29.
Parthiban M, Madhavan R, Porkodi R, Rajendran CP, Zake L, Sanjeevi CB, et al. Class II MHC alleles in rheumatoid arthritis in Tamil Nadu, India: Is there an association? Ann N Y Acad Sci 2002;958:412-5.  Back to cited text no. 29
    
30.
Winchester R. The molecular basis of susceptibility to rheumatoid arthritis. Adv Immunol 1994;56:389-466.  Back to cited text no. 30
    
31.
Emery P, Salmon M, Bradley H, Wordsworth P, Tunn E, Bacon PA, et al. Genetically determined factors as predictors of radiological change in patients with early symmetrical arthritis. BMJ 1992;305:1387-9.  Back to cited text no. 31
    
32.
Nepom GT. HLA DR4 and rheumatoid arthritis. In: Wolfe F, Pincus T, editors. Prognosis and Treatment of Rheumatic Diseases. New York: Marcel Dekker; 1994. p. 115-29.  Back to cited text no. 32
    
33.
Gourraud PA, Dieudé P, Boyer JF, Nogueira L, Cambon-Thomsen A, Mazières B, et al. A new classification of HLA-DRB1 alleles differentiates predisposing and protective alleles for autoantibody production in rheumatoid arthritis. Arthritis Res Ther 2007;9:R27.  Back to cited text no. 33
    
34.
van Gaalen FA, van Aken J, Huizinga TW, Schreuder GM, Breedveld FC, Zanelli E, et al. Association between HLA class II genes and autoantibodies to cyclic citrullinated peptides (CCPs) influences the severity of rheumatoid arthritis. Arthritis Rheum 2004;50:2113-21.  Back to cited text no. 34
    
35.
Huizinga TW, Amos CI, van der Helm-van Mil AH, Chen W, van Gaalen FA, Jawaheer D, et al. Refining the complex rheumatoid arthritis phenotype based on specificity of the HLA-DRB1 shared epitope for antibodies to citrullinated proteins. Arthritis Rheum 2005;52:3433-8.  Back to cited text no. 35
    
36.
Hinks A, Barton A, John S, Bruce I, Hawkins C, Griffiths CE, et al. Association between the PTPN22 gene and rheumatoid arthritis and juvenile idiopathic arthritis in a UK population: Further support that PTPN22 is an autoimmunity gene. Arthritis Rheum 2005;52:1694-9.  Back to cited text no. 36
    
37.
Burkhardt H, Hüffmeier U, Spriewald B, Böhm B, Rau R, Kallert S, et al. Association between protein tyrosine phosphatase 22 variant R620W in conjunction with the HLA-DRB1 shared epitope and humoral autoimmunity to an immunodominant epitope of cartilage-specific type II collagen in early rheumatoid arthritis. Arthritis Rheum 2006;54:82-9.  Back to cited text no. 37
    
38.
Pradhana VD, Dalvib H, Parsannavare D, Rajadhyakshad A, Patwardhane M, Ghosh K. Study of PTPN22 1858C/T polymorphism in rheumatoid arthritis patients from Western India. Indian J Rheumatol 2012;7:130-4.  Back to cited text no. 38
    
39.
Totaro MC, Tolusso B, Napolioni V, Faustini F, Canestri S, Mannocci A, et al. PTPN22 1858C>T polymorphism distribution in Europe and association with rheumatoid arthritis: Case-control study and meta-analysis. PLoS One 2011;6:e24292.  Back to cited text no. 39
    
40.
Orozco G, Pascual-Salcedo D, López-Nevot MA, Cobo T, Cabezón A, Martín-Mola E, et al. Auto-antibodies, HLA and PTPN22: Susceptibility markers for rheumatoid arthritis. Rheumatology (Oxford) 2008;47:138-41.  Back to cited text no. 40
    
41.
Sahin N, Gunduz F, Inanc N, Direskeneli H, Saruhan-Direskeneli G. No association of PTPN22 gene polymorphism with rheumatoid arthritis in Turkey. Rheumatol Int 2009;30:81-3.  Back to cited text no. 41
    
42.
Naseem H, Thomson W, Silman A, Worthington J, Symmons D, Barton A. The PTPN22*C1858T functional polymorphism is associated with susceptibility to inflammatory polyarthritis but neither this nor other variants spanning the gene is associated with disease outcome. Ann Rheum Dis 2008;67:251-5.  Back to cited text no. 42
    
43.
Plenge RM, Padyukov L, Remmers EF, Purcell S, Lee AT, Karlson EW, et al. Replication of putative candidate-gene associations with rheumatoid arthritis in>4,000 samples from North America and Sweden: Association of susceptibility with PTPN22, CTLA4, and PADI4. Am J Hum Genet 2005;77:1044-60.  Back to cited text no. 43
    
44.
Karlson EW, Chibnik LB, Cui J, Plenge RM, Glass RJ, Maher NE, et al. Associations between human leukocyte antigen, PTPN22, CTLA4 genotypes and rheumatoid arthritis phenotypes of autoantibody status, age at diagnosis and erosions in a large cohort study. Ann Rheum Dis 2008;67:358-63.  Back to cited text no. 44
    



 
 
    Tables

  [Table 1], [Table 2], [Table 3], [Table 4], [Table 5], [Table 6], [Table 7]



 

Top
 
 
  Search
 
Similar in PUBMED
   Search Pubmed for
   Search in Google Scholar for
 Related articles
Access Statistics
Email Alert *
Add to My List *
* Registration required (free)

 
  In this article
Abstract
Introduction
Methods
Results
Discussion
References
Article Tables

 Article Access Statistics
    Viewed455    
    Printed4    
    Emailed0    
    PDF Downloaded29    
    Comments [Add]    

Recommend this journal


[TAG2]
[TAG3]
[TAG4]