Tab Application Banner
  • Users Online: 2472
  • Home
  • Print this page
  • Email this page
Home About us Editorial board Ahead of print Current issue Search Archives Submit article Instructions Subscribe Contacts Login 


 
 Table of Contents  
LETTER TO EDITOR
Year : 2021  |  Volume : 16  |  Issue : 1  |  Page : 113-114

Is single nucleotide polymorphism of the FAS A-670G gene associated with systemic lupus erythematosus patients from South Indian tamils?


1 Department of Microbiology, Presidency College, Chennai, Tamil Nadu, India
2 Laboratory Division, ICMR-National Institute of Epidemiology, Chennai, Tamil Nadu, India

Date of Submission17-Aug-2020
Date of Acceptance13-Oct-2020
Date of Web Publication23-Mar-2021

Correspondence Address:
Dr. Manikandan Natesan
Department of Microbiology, Presidency College, Chennai - 600 005, Tamil Nadu
India
Login to access the Email id

Source of Support: None, Conflict of Interest: None


DOI: 10.4103/injr.injr_227_20

Rights and Permissions

How to cite this article:
Natesan M, Narasingam A, Balasubramanian G. Is single nucleotide polymorphism of the FAS A-670G gene associated with systemic lupus erythematosus patients from South Indian tamils?. Indian J Rheumatol 2021;16:113-4

How to cite this URL:
Natesan M, Narasingam A, Balasubramanian G. Is single nucleotide polymorphism of the FAS A-670G gene associated with systemic lupus erythematosus patients from South Indian tamils?. Indian J Rheumatol [serial online] 2021 [cited 2021 Dec 2];16:113-4. Available from: https://www.indianjrheumatol.com/text.asp?2021/16/1/113/309611



Dear Editor,

Systemic lupus erythematosus (SLE) is a severe rheumatic disease that affects multiple tissues and organs. FAS/FASL pathway plays a critical role in apoptosis process; therefore, the apoptosis gene FAS is the candidate gene in SLE predisposition.[1],[2] Therefore, the aim of this present study was to investigate the association of apoptosis gene, FAS A-670G (rs1800682) polymorphism, with SLE susceptibility in South Indian Tamils.

A total of 83 SLE patients and 50 age-matched healthy subjects were included. The study was approved by the Ethical Committee of Madras Medical College and Hospital, Chennai, Tamil Nadu, and informed written consent was obtained from each participant. Blood samples were collected, and genomic DNA was extracted by a rapid, nonenzymatic method.[3] The polymorphic site at nucleotide position-670 in the enhancer region of the FAS gene was amplified, and the genotypes were detected by polymerase chain reaction (PCR)-restriction fragment length polymorphism method using the following primers: forward-5'CTACCTAAGAGCTATCTACCGTTC3' and reverse 5'GGCTGTCCATGTTGTGGCTGC3'.[1] The amplified PCR product of FAS gene was digested with restriction enzyme BstN1 (New England Biolabs, MA, USA).

The 331 bp PCR amplicon copies were digested various fragments by the BstNI [Figure 1]. The AA, AG, and GG genotype frequencies of the FAS A-670G in SLE patients and controls were 28.9%, 56.62%, and 14.45% and 40%, 46%, and 14%, respectively. The A and G allele frequencies were 57% and 43% in SLE cases and 63% and 37% in controls. The frequency of the AA genotype of FAS A-670G polymorphism was lower in SLE patients (29%) as compared to controls (40%). However, the frequency of the AG genotype was higher in SLE patients (57%) compared with controls (46%) and the risk of SLE was 1.7-fold greater in individuals with AG genotype in comparison to AA genotype (odds ratio, 1.7 [95% confidence interval, 0.7–3.6]; P = 1.7). There were no differences between SLE patients (14.4%) and controls (14%) in the case of GG genotype (P = 0.5). The frequency of G allele was higher in the SLE group (42.7%) as compared to controls (37%).
Figure 1: Restriction fragment length polymorphism of FAS A-670G gene polymorphism in SLE by BstNI. The FAS gene wild-type allele (a) has one restriction site that produces two fragments (233 and 98 bp). When the A allele is replaced by G, the 233 bp fragment is further cleaved into two fragments (189 and 44 bp) because the replacement creates a new BstNI restriction site

Click here to view


The results of this study found no significant association of FAS genotypes and alleles in SLE patients and controls. In contrast to the present study, a significant difference was observed in AA genotype frequency between Iranian SLE patients and controls in comparison to GG genotype, and the risk of SLE was 2.1-fold higher in subjects with AA genotype.[1] Our study results were agreeing with the study by Lee et al.,[4] who had reported that the genotype distribution of the FAS promoter 670 did not differ between patients with SLE and control subjects. In another study, Lee et al.[5] had reported that the FAS 670 A/G polymorphisms confer susceptibility to autoimmune rheumatic diseases and FAS 670G allele was negatively associated with SLE susceptibility.

In conclusion, association of FAS A-670G gene polymorphism does not appear to be a risk factor for SLE in Southern Indian Tamils. Further studies are needed to illuminate the role of FAS A-670G gene polymorphism in SLE susceptibility.

Financial support and sponsorship

Nil.

Conflicts of interest

There are no conflicts of interest.



 
  References Top

1.
Moudi B, Salimi S, Farajian Mashhadi F, Sandoughi M, Zakeri Z. Association of FAS and FAS ligand genes polymorphism and risk of systemic lupus erythematosus. ScientificWorldJournal 2013;2013:176741.  Back to cited text no. 1
    
2.
Pradhan VD. APO1/F AS promoter polymorphism in systemic lupus erythematosus (SLE): Significance in clinical expression of the disease. J Assoc Physicians India 2012;60:34-7.  Back to cited text no. 2
    
3.
Lahiri DK, Schnabel B. DNA isolation by a rapid method from human blood samples: Effects of MgCl2, EDTA, storage time, and temperature on DNA yield and quality. Biochem Genet 1993;31:321-8.  Back to cited text no. 3
    
4.
Lee YH, Kim YR, Ji JD, Sohn J, Song GG. Fas promoter-670 polymorphism is associated with development of anti-RNP antibodies in systemic lupus erythematosus. J Rheumatol 2001;28:2008-11.  Back to cited text no. 4
    
5.
Lee YH, Bae SC, Choi SJ, Ji JD, Song GG. Associations between the FAS-670 A/G and -1,377 G/A polymorphisms and susceptibility to autoimmune rheumatic diseases: A meta-analysis. Mol Biol Rep 2012;39:10671-9.  Back to cited text no. 5
    


    Figures

  [Figure 1]



 

Top
 
 
  Search
 
Similar in PUBMED
   Search Pubmed for
   Search in Google Scholar for
Access Statistics
Email Alert *
Add to My List *
* Registration required (free)

 
  In this article
References
Article Figures

 Article Access Statistics
    Viewed602    
    Printed27    
    Emailed0    
    PDF Downloaded44    
    Comments [Add]    

Recommend this journal


[TAG2]
[TAG3]
[TAG4]