Tab Application Banner
  • Users Online: 175
  • Home
  • Print this page
  • Email this page
Home About us Editorial board Ahead of print Current issue Search Archives Submit article Instructions Subscribe Contacts Login 

 
ORIGINAL ARTICLE
Ahead of print publication  

Expression of two long noncoding ribonucleic acids (growth arrest-specific 5 and H19) in rheumatoid arthritis patients: Relation to clinical characteristics and disease activity


1 Department of Medical Biochemistry, National Research Centre, Cairo, Egypt; Department of Clinical Biochemistry, Faculty of Medicine, King Abdulaziz University, Jeddah, Saudi Arabia
2 Department of Medical Biochemistry and Molecular Biology, Faculty of Medicine, Cairo University, Cairo, Egypt
3 Department of Medical Biochemistry, National Research Centre, Cairo, Egypt
4 Department of Internal Medicine, Faculty of Medicine, Zagazig University, Zagazig, Egypt
5 Department of Rheumatology, Faculty of Medicine, Cairo University, Cairo, Egypt

Date of Submission16-Jul-2020
Date of Acceptance23-Nov-2020

Correspondence Address:
Gehan Abdel-Fattah Hegazy,
Department of Clinical Biochemistry, Faculty of Medicine, King Abdulaziz University, P.O. Box 80205, Jeddah 21589

Login to access the Email id

Source of Support: None, Conflict of Interest: None

DOI: 10.4103/injr.injr_190_20

  Abstract 


Background: Rheumatoid arthritis (RA) is a relatively common autoimmune disease in which genetic risk factors are well defined. Genetic studies are promising in exploring the long noncoding ribonucleic acids (lncRNAs): growth arrest-specific 5 (GAS5) and H19, and their possible role in the assessment of RA.
Aim of the Work: The aim of the study was to describe the expression of GAS5 and H19 in serum samples of Egyptian RA patients in comparison to healthy controls, then to investigate its possible relation to RA clinical characteristics and disease activity.
Patients and Methods: Levels of GAS5 and H19 expression were compared in serum samples from Egyptian RA patients (n = 100) and age- and sex-matched healthy controls (n = 100) and then correlated within the RA group to disease activity measured by the Disease Activity Score 28–erythrocyte sedimentation rate (DAS28-ESR).
Results: GAS5 was downregulated (0.59 ± 0.36), while H19 was upregulated (7.41 ± 1.3) in sera of Egyptian RA patients in comparison with controls (1.07 ± 0.09 and 1.1 ± 0.09 respectively). Further analysis showed a significant negative correlation of GAS5 to DAS28-ESR (r = -0.380). However, H19 showed a positive correlation to DAS28-ESR (r = 0.487 (P < 0.05).
Conclusion: GAS5 was related to less disease activity, while H19 tended to be associated with more active disease. They might be useful in RA as potential biomarkers for disease activity assessment in the following years. Still, further researches are needed to support our findings and precisely determine their potential utility in RA.

Keywords: Disease Activity Score 28-erythrocyte sedimentation rate, growth arrest-specific 5, H19, long noncoding ribonucleic acid, rheumatoid arthritis



How to cite this URL:
Hegazy GA, Shaker O, Aly O, Zaki HH, Herzalla MR, Gomaa AF, Sayed S, Haroon MM. Expression of two long noncoding ribonucleic acids (growth arrest-specific 5 and H19) in rheumatoid arthritis patients: Relation to clinical characteristics and disease activity. Indian J Rheumatol [Epub ahead of print] [cited 2021 Feb 26]. Available from: https://www.indianjrheumatol.com/preprintarticle.asp?id=309610




  Introduction Top


Rheumatoid arthritis (RA) is among the most prevalent chronic autoimmune diseases. Almost 1% of people all over the world are affected by RA. It is characterized by synovial tissue inflammation leading to peripheral joint destruction and bony erosions, as well as systemic inflammation.[1] If left untreated, it can lead to a reduced quality of life among patients and their families due to a wide array of functional disabilities, pain, and comorbidities.[2] The precise mechanisms involved in RA pathogenesis are currently not completely understood. However, accumulated results from epidemiological studies have suggested genetics and environmental factors, like smoking, among RA risk factors.[3] This association between the genetic and the environmental factors in RA and many other inflammatory processes led to the research field known as epigenetics, involving the study of the modification of deoxyribonucleic acids (DNA) (including methylation and histone acetylation) and the transcription of noncoding ribonucleic acids (ncRNAs).[4]

Long noncoding ribonucleic acids (lncRNAs) refer to the genome in which the accumulation of transcripts is >200 nucleotides and that do not encode protein.[5] These transcripts were thought to have no biological functions, hence considered genome dark matter.[3] Nevertheless, recent evidence has shown that they have a role in many biological processes such as inflammation, aberrant proliferation, migration, invasion, and apoptosis.[6] Moreover, they are participating in the regulation and growth of different immune cell lines and regulate gene expression programs in those cells.[7] Consequently, lncRNAs are gaining much of the interest being involved in a variety of autoimmunity- and inflammation-related processes such as RA, systemic lupus erythematosus (SLE), multiple sclerosis, and SjÖgren's syndrome.[8],[9] To date, over 14,000 lncRNAs have been identified in humans.[10] This special class of transcripts has been linked to inflammatory processes, cancer, and autoimmunity.[11],[12],[13] The specific role they play in inflammation is still being explored. It seems that they can interact with immune cells producing inflammatory and immunological responses via the signaling pathway for the nuclear factor-kB.[14],[15],[16] Recent researches have shown that several dysregulated lncRNAs participate in the RA inflammatory response.[13],[14],[17] Growing evidence showed that lncRNAs can control microRNAs through behaving as competitive endogenous RNAs, thus contributing to autoimmune diseases like RA.[18],[19]

It is well-known that the main immune cell players in RA pathogenesis are T-lymphocytes (Th1, Th17, and Treg), B-lymphocytes, macrophages, and fibroblast-like synoviocytes (FLS), in addition to their cytokines. In T-cells, many lncRNAs are found expressed in all cell phases indicating their emerging role in the regulation of immune cell development and functions.[20] LncRNAs appear to exert that role in T-cells through direct interaction with signaling molecules.[21] Growing evidence is linking numerous lncRNAs with T-cell function. By controlling T-cell activation, apoptosis, and differentiation, lncRNAs regulate the inflammatory process in RA.[1] Researchers discovered hundreds of lymphoid-specific lncRNAs that affected CD8+ T-cell differentiation into CD8+ memory and effector T-cells. Furthermore, the differentiation of CD4+ T-cells into TH1 and TH2 subsets was regulated by specific TH1- and TH2-related transcription factors, respectively.[22] In B-lymphocytes, lncRNAs are incorporated in chromatin remodeling associated with the production of antigen receptors (Ig or T-cell receptor). The inflammatory cells (T, B, and antigen-presenting cells), attracted to the synovium by chemokines and cytokines, secrete proteases that ultimately lead to joint destruction.[23]

FLSs (FLS or type B synoviocytes) proliferate and invade cartilage and bone in RA, thus considered a possible target in RA treatment.[24] High expression of some lncRNAs and downregulation of others regulated the migrative and invasive capabilities of these cells,[25] as well as their proliferation and motility affecting their mRNA protein expression.[26]

Among the recently studied lncRNAs which are found to be implicated in RA pathophysiology are the growth arrest-specific gene 5 (GAS5) and H19. In RA patients, GAS5 was shown to induce apoptosis of FLSs through the phosphatidylinositol 3 kinase/protein kinase B (PI3K/AKT) pathway. The promotion of apoptosis of RA FLS plays a pivotal role in RA treatment.[27] GAS5 level is decreased in RA FLS; however, its level increases after treatment with tanshinone IIA which is used to induce apoptosis of RA FLS. The knockdown of GAS5 decreases caspase-3 and caspase-9 levels and stimulates the PI3K/AKT signaling pathway.[26]

Another lncRNA, H19, is located on chromosome 11 in humans and has differential expression in inflamed joint tissue.[4] H19 is involved in tumor proliferation, invasion, and metastasis.[28] Stuhlmüller et al. demonstrated higher H19 expression in synovial tissue (especially synovial macrophages and fibroblasts) in RA patients compared to healthy controls.[29]

Great efforts are required to explore different lncRNAs and understand their function in RA pathogenesis and disease activity, speculating that they might be a possible objective for diagnosis and therapy of this high-burden disease. Hence, our study aimed at describing GAS5 and H19 expression in Egyptian RA patients and investigating its possible relation to RA clinical characteristics and disease activity.


  Patients and Methods Top


Sample size estimation

The Raosoft software package was used for sample size calculation, and the single proportion method was used. By assuming that 50% of patients will have RA and based on the number of RA patients mention in the manuscript made in Egypt by Moaaz and Mohannad 2016,[30] the required sample size was 91 patients at a 99% confidence interval and a 5% margin of error, but a sample size of 100 patients was used in this study for better representation of patients.

Study design

This is a case–control study that was conducted from July 2016 to October 2018 and included 200 subjects: 100 Egyptian RA patients and 100 healthy volunteers who represent the control group. Both the groups were similar in age and sex (they were between 21–45 years of age). RA patients were recruited from the outpatient clinic Rheumatology Department of the Kasr Al Aini Hospital, Cairo University; the healthy controls were recruited from healthy blood donors of the hospital. Full history taking, comprehensive medical examination, and biochemical analysis have been done for all participants in this study. RA patients met the 2010 RA classification criteria of the American College of Rheumatology/European League Against Rheumatism.[31] Each participant signed written informed consent. The research protocol followed the principles of the Helsinki Declaration and was approved by Kasr Al Aini Faculty of Medicine Ethical Committee, Cairo University.

The Disease Activity Score 28-erythrocyte sedimentation rate (DAS28-ESR)[32] was used to measure the disease activity in subjects with RA. The calculation formula for DAS28-ESR included the counts of tender and swollen joints (tender joint count [TJC], and swollen joint count [SJC] based on a 28-joint assessment), self-assessment of health using the visual analog scale (0 ± 10 cm), and ESR ([1st h in mm/h]). Based on DAS28-ESR, disease severity was interpreted as remission (DAS28-ESR =2.6), low (2.6< DAS28-ESR =3.2), moderate (3.2< DAS28-ESR =5.1), or high (DAS28-ESR >5.1).

Biochemical analysis

From each participant, a peripheral blood sample (10 ml) was withdrawn, then the first (5 ml) blood sample was collected into plain tubes and left for clotting then centrifuged at 3000 × g for 10 min for preparing serum. The serum samples were stored at -80°C for the following further biochemical assessment. The serum creatinine and serum alanine transaminase were tested using the colorimetric enzymatic approach using kits obtained from Cayman Chemical with the following catalogs (Cat. No. 700460, Cat. No. 700260, Cayman Chemical, Michigan, USA). Rheumatoid factor (RF) was measured using the Human Rheumatoid Factor ELISA Kit (Cat. No. MBS721682, MyBioSource, Inc., San Diego, CA, USA). Antinuclear antibody was tested by indirect immune fluorescence provided by Immco Diagnostics (USA).

Then, 3 ml was withdrawn in ethylenediaminetetraacetic acid tubes for estimation of complete blood count (Coulter STKS hematology ow cytometer, Block Scientific, Inc., Bohemia, New York, USA), and 2 ml was obtained in tubes containing sodium citrate for estimation of ESR. ESR was estimated and reported in mm/h using the Westergren technique.

Molecular analysis

Ribonucleic acid extraction, cDNA synthesis, and quantitation polymerase chain reaction

The total RNA was extracted from the serum samples with QIA amp RNA Blood Mini Kit (Qiagen, Germany). The extracted RNA stored at -80°C. A NanoDrop spectrophotometer was used to assess the RNA concentration of all samples. cDNA was synthesized from 1 μg of total RNA using the QuantiTect Reverse Transcription Kit (Qiagen, Germany), as instructed by the manufacturer. Real-time polymerase chain reaction (PCR) was done in triplicates using the Rotor-Gene Q (Qiagen, Germany).

PCR was carried out with the Maxima SYBR Green quantitative PCR (qPCR) kit (Thermo Scientific, USA) following the manufacturer's protocol. Real-time PCR has been performed. lncRNA's gene expression was determined relative to GAPDH which served as an internal control based on the cycle threshold method (2-ΔCt). The Ct is the cycle's number needed in quantitative real-time (qPCR) for crossing the threshold fluorescent signal. Fold change was calculated using 2-ΔΔCt formula, fold-change values above 1 indicate upregulation, and fold-change values below 1 indicate downregulation.

Primers used in real-time quantitative polymerase chain reaction experiments are as following

  • The H19 forward primer is TGCTGCACTTTACAACCACTG and the reverse primer is ATGGTGTCTTTGATGTTGGGC
  • The GAS5 forward primer is 5'TATGGTGCTGGGTGCGGAT3' and the reverse primer is 5'CCAATGGCTTGAGTTAGGCTT3'
  • The GAPDH forward primer is 5'-AGACTGGCTCTTAAAAAGTGCAGG-3' and the reverse primer is 5'-GCTGTAGCCAAATTCGTTGTCA-3'.


The quality and reproducibility of polymerase chain reaction tests were achieved in this polymerase chain reaction by the following steps to be sure of the good quality and reproducibility

  1. Primer design, all primers were ready made by Qiagen
  2. Every sample was done in triplicate
  3. Negative control was included in each reaction
  4. The melting curve was followed at the end of each PCR.


Statistical analysis

The data analysis was carried out using SPSS (version 20) Data were presented as mean +/- standard deviation (SD) and were analysed by IBM SPSS Statistics for Windows, version 20 (IBM SPSS, IBM Corp., Armonk, N.Y., USA). Data between patients and controls were represented as mean ± standard deviation or number (%) as suitable. Significance was made using unpaired Student's t-test for parametric data and Chi-square test for nonparametric data. Within the patients' group only, data were expressed as correlation coefficient and significance. Correlation between the expression levels of GAS5, H19, and the clinical and laboratory features was analyzed using the Pearson correlation test for parametric data and Spearman correlation for nonparametric data. P < 0.05 has been recognized as statistically significant.


  Results Top


One hundred Egyptian RA patients participated in the current study and compared to one hundred healthy controls. The patients and controls were not significantly different as regards age and sex. GAS5 level was significantly lower in patients with RA than controls (P < 0.05). Meanwhile, H19 was significantly higher in RA patients versus controls (P < 0.05). ESR was significantly higher in RA patients versus controls (P < 0.05). RF was positive in 65 RA patients (65%), and ANA was positive in 30 RA patients (30%). Both the antibodies were absent totally in the control group [Table 1].
Table 1: Comparison between patients and controls in clinical and laboratory-measured parameters

Click here to view


The RA group was further analyzed for the correlation of serum levels of GAS 5 and H19 to various clinical and laboratory characteristics.

Serum GAS 5 level showed a significant negative correlation to disease duration, morning stiffness by minutes (MS by min), ESR, RF and ANA positivity, presence of rheumatoid nodules, TJC, SJC, and DAS28-ESR (P < 0.05). Serum H19 level showed a significant positive correlation to disease duration, MS (by min), RF and ANA positivity, presence of rheumatoid nodules, TJC, SJC, and DAS28-ESR (P < 0.05). Interestingly, H19 showed a weak positive relation to ESR which is not statistically significant (P = 0.347) [Table 2] and [Figure 1].
Table 2: Correlation of growth arrest-specific and imprinted maternally expressed transcript (identified as the 19th clone in row H) to different measured parameters within the rheumatoid arthritis group

Click here to view
Figure 1: Correlation of growth arrest-specific 5 and H19 to disease activity score Disease Activity Score 28

Click here to view


Serum GAS5 level, also, demonstrated a significantly negative correlation to H19 (r = -0.596, P < 0.05) [Figure 2].
Figure 2: Correlation of growth arrest-specific 5 to H19

Click here to view



  Discussion Top


In the present study, we compared the expression levels of two lncRNAs (GAS5 and H19) between RA patients and healthy controls. In addition, we investigated the association of either lncRNA with DAS28-ESR in RA patients.

We demonstrated that the GAS5 expression level was significantly downregulated in the serum of RA patients. The exact function of GAS5 in RA pathogenesis is inadequately studied. GAS5, encoded at chromosome 1q25, was previously proven to enhance the apoptosis of endothelial cells, tumor cells, macrophages, and RAFLS.[33],[34],[35] GAS5 overexpression has resulted in a higher apoptotic rate of FLS.[33] The expression of GAS5 in RA FLSs was found to be downregulated compared to that in healthy controls.[27] Besides, in ovarian malignancy, GAS5 adversely affects the level of interleukin (IL)-18. As such cytokine is implicated in the development of RA; this may indicate the potential participation of GAS5 in RA. Furthermore, GAS5 levels were significantly lower in patients with SLE in peripheral blood B cells and CD4+ T-cells, and so GAS5 can inhibit T-cell activation and proliferation.[36],[37]

In the present study, the H19 expression level was significantly higher in the serum of RA patients compared to healthy controls. H19 is a maternally expressed gene present on chromosome 11in humans. H19 is highly present in embryonal tissue then decreases after birth, indicating its role in embryogenesis.[3] It plays an important role in tumor pathogenesis.[1] H19 was shown to have a fundamental role in metastasis, carcinogenesis, and autoimmune diseases.[38] Levels of H19 in ulcerative colitis tissues were significantly higher in comparison with normal tissues.[39] Stuhlmüller et al. showed that the expression of H19 was significantly upgraded in RA synovial tissue compared to normal joints. Significant upregulation of H19 in RA strongly indicates the involvement of this gene in the pathogenesis and/or inflammatory/oxidative stress of the synovial tissue.[29] Besides, the H19 level in synovial macrophages was correlated to RF positivity.[3]

The current attention to the role of lncRNAs in autoimmune diseases is mainly directed toward disclosing the possible pathogenetic mechanisms of these transcripts in RA. However, the influence of these genes on RA disease activity is not adequately addressed. Yuan et al. stated that some lncRNAs affected the activity of the disease in RA patients. Their study demonstrated that the expression levels of certain lncRNA (ENST00000456270) were strongly related to the Simplified Disease Activity Index in patients with RA. Moreover, they found the level of that lncRNA is significantly linked to serum IL-6 and tumor necrosis factor-α levels.[40] To our knowledge, we are the first to examine the relation of the expression of GAS5 and H19 to the disease activity in RA measured by DAS28-ESR. We displayed that GAS5 and H19 have an influence on RA disease in Egyptian patients. This aroused when the correlation was estimated between the levels of these lncRNAs and the clinical features and the laboratory parameters and RA activity level on DAS28-ESR. According to our data, GAS5 levels were significantly related to less disease activity in Egyptian patients with RA. This indicates that GAS5 could be considered as a protective code in RA. On the other hand, higher levels of H19 were found significantly linked with more active disease, which indicates that it might be utilized as a biomarker for evaluating RA disease activity.


  Conclusion Top


GAS5 and H19 have differential expression in RA patients where GAS5 is related to less activity, while H19 tended to be linked with more active disease. However, further multicenter researches are required to support our results, precisely explore their role in pathogenesis and their potential utility in disease activity evaluation, and determine the strategy they can be used with.

Financial support and sponsorship

Nil.

Conflicts of interest

There are no conflicts of interest.



 
  References Top

1.
Fang Y, Tu J, Han D, Guo Y, Hong W, Wei W. The effects of long non-coding ribonucleic acids on various cellular components in rheumatoid arthritis. Rheumatology (Oxford) 2020;59:46-56.  Back to cited text no. 1
    
2.
Shaker OG, Alnoury AM, Hegazy GA, El Haddad HE, Sayed S, Hamdy A. Methylene tetrahydrofolate reductase, transforming growth factor-β1 and lymphotoxin-α genes polymorphisms and susceptibility to rheumatoid arthritis. Rev Bras Reumatol Engl Ed 2016;56:414-20.  Back to cited text no. 2
    
3.
Zhou JZ, Li JJ, Hua DJ, Huang SC, Sun QQ, Huang H, et al. A study on associations of single-nucleotide polymorphisms within H19 and HOX transcript antisense RNA (HOTAIR) with genetic susceptibility to rheumatoid arthritis in a Chinese population. Inflamm Res 2017;66:515-21.  Back to cited text no. 3
    
4.
Pearson MJ, Jones SW. Review: Long noncoding RNAs in the regulation of inflammatory pathways in rheumatoid arthritis and osteoarthritis. Arthritis Rheumatol 2016;68:2575-83.  Back to cited text no. 4
    
5.
Wu J, Zhang TP, Zhao YL, Li BZ, Leng RX, Pan HF, et al. Decreased H19, GAS5, and linc0597 expression and association analysis of related gene polymorphisms in rheumatoid arthritis. Biomolecules 2019;10:55.  Back to cited text no. 5
    
6.
Cremer S, Michalik KM, Fischer A, Pfisterer L, Jae N, Winter C, et al. Hematopoietic deficiency of the long noncoding RNA MALAT1 promotes atherosclerosis and plaque inflammation. Circulation 2019;139:1320-34.  Back to cited text no. 6
    
7.
Atianand MK, Caffrey DR, Fitzgerald KA. Immunobiology of long noncoding RNAs. Annu Rev Immunol 2017;35:177-98.  Back to cited text no. 7
    
8.
Cardamone G, Paraboschi EM, Solda G, Cantoni C, Supino D, Piccio L, et al. Not only cancer: the long non-coding RNA MALAT1 affects the repertoire of alternatively spliced transcripts and circular RNAs in multiple sclerosis. Hum Mol Genet 2019;28:1414-28.  Back to cited text no. 8
    
9.
Xu F, Jin L, Jin Y, Nie Z, Zheng H. Long noncoding RNAs in autoimmune diseases. J Biomed Mater Res A 2019;107:468-75.  Back to cited text no. 9
    
10.
Derrien T, Johnson R, Bussotti G, Tanzer A, Djebali S, Tilgner H, et al. The GENCODE v7 catalog of human long noncoding RNAs: Analysis of their gene structure, evolution, and expression. Genome Res 2012;22:1775-89.  Back to cited text no. 10
    
11.
Motawi TM, El-Maraghy SA, Sabry D, Mehana NA. The expression of long non coding RNA genes is associated with expression with polymorphisms of HULC rs7763881 and MALAT1 rs619586 in hepatocellular carcinoma and HBV Egyptian patients. J Cell Biochem 2019;120:14645-56.  Back to cited text no. 11
    
12.
Toraih EA, Alghamdi SA, El-Wazir A, Hosny MM, Hussein MH, Khashana MS, et al. Dual biomarkers long non-coding RNA GAS5 and microRNA-34a co-expression signature in common solid tumors. PLoS One 2018;13:e0198231.  Back to cited text no. 12
    
13.
El Samaloty NM, Shabayek MI, Ghait RS, El-Maraghy SA, Rizk SM, El-Sawalhi MM. Assessment of lncRNA GAS5, lncRNA HEIH, lncRNA BISPR and its mRNA BST2 as serum innovative non-invasive biomarkers: Recent insights into Egyptian patients with hepatitis C virus type 4. World J Gastroenterol 2020;26:168-83.  Back to cited text no. 13
    
14.
Lu MC, Yu HC, Yu CL, Huang HB, Koo M, Tung CH, et al. Increased expression of long noncoding RNAs LOC100652951 and LOC100506036 in T cells from patients with rheumatoid arthritis facilitates the inflammatory responses. Immunol Res 2016;64:576-83.  Back to cited text no. 14
    
15.
Mao X, Su Z, Mookhtiar AK. Long non-coding RNA: A versatile regulator of the nuclear factor-γappaB signalling circuit. Immunology 2017;150:379-88.  Back to cited text no. 15
    
16.
Zhang Y, Xu YZ, Sun N, Liu JH, Chen FF, Guan XL, et al. Long noncoding RNA expression profile in fibroblast-like synoviocytes from patients with rheumatoid arthritis. Arthritis Res Ther 2016;18:227.  Back to cited text no. 16
    
17.
Mousavi MJ, Jamshidi A, Chopra A, Aslani S, Akhlaghi M, Mahmoudi M. Implications of the noncoding RNAs in rheumatoid arthritis pathogenesis. J Cell Physiol 2018;234:335-47.  Back to cited text no. 17
    
18.
Hur K, Kim SH, Kim JM. Potential Implications of Long Noncoding RNAs in Autoimmune Diseases. Immune Netw 2019;19:e4.  Back to cited text no. 18
    
19.
Jiang H, Ma R, Zou S, Wang Y, Li Z, Li W. Reconstruction and analysis of the lncRNA-miRNA-mRNA network based on competitive endogenous RNA reveal functional lncRNAs in rheumatoid arthritis. Mol Biosyst 2017;13:1182-92.  Back to cited text no. 19
    
20.
Moharamoghli M, Hassan-Zadeh V, Dolatshahi E, Alizadeh Z, Farazmand A. The expression of GAS5, THRIL, and RMRP lncRNAs is increased in T cells of patients with rheumatoid arthritis. Clin Rheumatol 2019;38:3073-80.  Back to cited text no. 20
    
21.
Sigdel KR, Cheng A, Wang Y, Duan L, Zhang Y. The emerging functions of long noncoding RNA in immune cells: Autoimmune diseases. J Immunol Res 2015;2015:848790.  Back to cited text no. 21
    
22.
Heward JA, Lindsay MA. Long non-coding RNAs in the regulation of the immune response. Trends Immunol 2014;35:408-19.  Back to cited text no. 22
    
23.
Duroux-Richard I, Jorgensen C, Apparailly F. miRNAs and rheumatoid arthritis Promising novel biomarkers. Swiss Med Wkly 2011;141:w13175.  Back to cited text no. 23
    
24.
Bottini N, Firestein GS. Duality of fibroblast-like synoviocytes in RA: Passive responders and imprinted aggressors. Nat Rev Rheumatol 2013;9:24-33.  Back to cited text no. 24
    
25.
Liu YR, Yang L, Xu QQ, Lu XY, Ma TT, Huang C, et al. Long noncoding RNA MEG3 regulates rheumatoid arthritis by targeting NLRC5. J Cell Physiol 2019;234:14270-84.  Back to cited text no. 25
    
26.
Zou Y, Xu S, Xiao Y, Qiu Q, Shi M, Wang J, et al. Long noncoding RNA LERFS negatively regulates rheumatoid synovial aggression and proliferation. J Clin Invest 2018;128:4510-24.  Back to cited text no. 26
    
27.
Li G, Liu Y, Meng F, Xia Z, Wu X, Fang Y, et al. Tanshinone IIA promotes the apoptosis of fibroblast-like synoviocytes in rheumatoid arthritis by up-regulating lncRNA GAS5. Biosci Rep2018;38:1-8.  Back to cited text no. 27
    
28.
Ding D, Li C, Zhao T, Li D, Yang L, Zhang B. LncRNA H19/miR-29b-3p/PGRN Axis promoted epithelial-mesenchymal transition of colorectal cancer cells by acting on wnt signaling. Mol Cells 2018;41:423-35.  Back to cited text no. 28
    
29.
Stuhlmüller B, Kunisch E, Franz J, Martinez-Gamboa L, Hernandez MM, Pruss A, et al. Detection of oncofetal h19 RNA in rheumatoid arthritis synovial tissue. Am J Pathol 2003;163:901-11.  Back to cited text no. 29
    
30.
Moaaz M, Mohannad N. Association of the polymorphisms of TRAF1 (rs10818488) and TNFAIP3 (rs2230926) with rheumatoid arthritis and systemic lupus erythematosus and their relationship to disease activity among Egyptian patients. Cent Eur J Immunol 2016;41:165-75.  Back to cited text no. 30
    
31.
Aletaha D, Neogi T, Silman AJ, Funovits J, Felson DT, Bingham 3rd CO, et al. 2010 Rheumatoid arthritis classification criteria: An American College of Rheumatology/European League Against Rheumatism collaborative initiative. Arthritis Rheum 2010;62:2569-81.  Back to cited text no. 31
    
32.
Prevoo ML, van 't Hof MA, Kuper HH, van Leeuwen MA, van de Putte LB, van Riel PL. Modified disease activity scores that include twenty-eight-joint counts. Development and validation in a prospective longitudinal study of patients with rheumatoid arthritis. Arthritis Rheum 1995;38:44-8.  Back to cited text no. 32
    
33.
Ma C, Wang W, Li P. LncRNA GAS5 overexpression downregulates IL-18 and induces the apoptosis of fibroblast-like synoviocytes. Clin Rheumatol 2019;38:3275-80.  Back to cited text no. 33
    
34.
Wang Y, Kong D. LncRNA GAS5 represses osteosarcoma cells growth and metastasis via sponging MiR-203a. Cell Physiol Biochem 2018;45:844-55.  Back to cited text no. 34
    
35.
Chen L, Yang W, Guo Y, Chen W, Zheng P, Zeng J, et al. Exosomal lncRNA GAS5 regulates the apoptosis of macrophages and vascular endothelial cells in atherosclerosis. PLoS One 2017;12:e0185406.  Back to cited text no. 35
    
36.
Mayama T, Marr AK, Kino T. Differential Expression of Glucocorticoid Receptor Noncoding RNA Repressor Gas5 in Autoimmune and Inflammatory Diseases. Horm Metab Res 2016;48:550-7.  Back to cited text no. 36
    
37.
Mourtada-Maarabouni M, Williams GT. Growth arrest on inhibition of nonsense-mediated decay is mediated by noncoding RNA GAS5. Biomed Res Int 2013;2013:358015.  Back to cited text no. 37
    
38.
Luo M, Li Z, Wang W, Zeng Y, Liu Z, Qiu J. Long non-coding RNA H19 increases bladder cancer metastasis by associating with EZH2 and inhibiting E-cadherin expression. Cancer Lett 2013;333:213-21.  Back to cited text no. 38
    
39.
Chen SW, Wang PY, Liu YC, Sun L, Zhu J, Zuo S, et al. Effect of long noncoding RNA H19 overexpression on intestinal barrier function and its potential role in the pathogenesis of ulcerative colitis. Inflamm Bowel Dis 2016;22:2582-92.  Back to cited text no. 39
    
40.
Yuan M, Wang S, Yu L, Qu B, Xu L, Liu L, et al. Long noncoding RNA profiling revealed differentially expressed lncRNAs associated with disease activity in PBMCs from patients with rheumatoid arthritis. PLoS One 2017;12:e0186795.  Back to cited text no. 40
    


    Figures

  [Figure 1], [Figure 2]
 
 
    Tables

  [Table 1], [Table 2]



 

 
Top
 
 
  Search
 
     Search Pubmed for
 
    -  Hegazy GA
    -  Shaker O
    -  Aly O
    -  Zaki HH
    -  Herzalla MR
    -  Gomaa AF
    -  Sayed S
    -  Haroon MM
    Access Statistics
    Email Alert *
    Add to My List *
* Registration required (free)  

 
  In this article
Abstract
Introduction
Patients and Methods
Results
Discussion
Conclusion
References
Article Figures
Article Tables

 Article Access Statistics
    Viewed60    
    PDF Downloaded4    

Recommend this journal